Stem-loop sequence ppt-MIR1060

AccessionMI0006019 (change log)
DescriptionPhyscomitrella patens miR1060 stem-loop
Stem-loop
   -----a ga  auau   gua    uu          -   a     u           aauuuuuucuugauaagac 
5'       g  ag    ucu   ccau  ucgaaccuuu guc uagga uacacacgcag                   c
         |  ||    |||   ||||  |||||||||| ||| ||||| |||||||||||                    
3'       c  uc    aga   ggua  aguuuggaaa cag auccu augugugcguc                   a
   cuauca ac  --gu   --a    --          a   -     u           gcuaaagugcaauccacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr10: 6366213-6366357 [-]
intergenic
Database links

Mature sequence ppt-miR1060

Accession MIMAT0005178
Sequence

30 - 

uuugucauaggauuacacacg

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).