Stem-loop sequence ppt-MIR1071

AccessionMI0006037 (change log)
DescriptionPhyscomitrella patens miR1071 stem-loop
Stem-loop
   gugaacua   c  --gac a       -             c        a        g     aaaa 
5'         ugu gc     g gauagga cccgcgcaauucc gaacgggu gaagaacc gaucu    a
           ||| ||     | ||||||| ||||||||||||| |||||||| |||||||| |||||     
3'         gca cg     c cuguccu gggcgcguuaagg cuugccca cuucuugg cuggg    u
   ----aaaa   a  aacac c       u             u        c        g     cgcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr03: 13102663-13102797 [+]
intergenic
Database links

Mature sequence ppt-miR1071-5p

Accession MIMAT0005199
Sequence

30 - 

gcgcaauucccgaacggguag

 - 50

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR1071-3p

Accession MIMAT0005200
Sequence

89 - 

acccguucuggaauugcgcgg

 - 109

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).