Stem-loop sequence smo-MIR1089

AccessionMI0006073 (change log)
DescriptionSelaginella moellendorffii miR1089 stem-loop
Stem-loop
   gacgaccucaa                               a       u       u         c   a           ag   gac   ca 
5'            ggaucaucuugcugcugugcaaacaauccua augaucu aaggaug gggagcaag aua aggauggagga  ggu   gag  c
              ||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||| ||| |||||||||||  |||   |||   
3'            ucuaguagaacgaugacacguuuguuaggau uacuaga uuccuac ccuucguuu uau uccuacuucuu  ucg   cuc  c
   -----------                               c       c       c         a   c           cu   --u   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence smo-miR1089

Accession MIMAT0005242
Sequence

145 - 

agaucaucuaggauuguuugc

 - 165

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).