Stem-loop sequence smo-MIR1098

AccessionMI0006085 (change log)
DescriptionSelaginella moellendorffii miR1098 stem-loop
Stem-loop
   -  -   -ca   c     a        c      u           a     
5'  gu ggc   ucg ugaug cguuugug ugaaau ugggaaugggu aagg 
    || |||   ||| ||||| |||||||| |||||| ||||||||||| ||| g
3'  cg cug   ggc acuac gcaaacac acuuua acccuugccca uucc 
   a  u   caa   -     c        u      u           c     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence smo-miR1098

Accession MIMAT0005254
Sequence

12 - 

ugaugacguuugugcugaaau

 - 32

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).