Stem-loop sequence tae-MIR1130a

AccessionMI0006192 (change log)
Previous IDstae-MIR1130
DescriptionTriticum aestivum miR1130 stem-loop
Gene family MIPF0000344; MIR818
Literature search

5 open access papers mention tae-MIR1130a
(12 sentences)

Stem-loop
   aaa   cuu     -  -                           auaa  uauguu  u  gua 
5'    ugu   auacu cc cuccgucucguaauguaagacguuuuu    gc      ag cu   a
      |||   ||||| || |||||||||||||||||||||||||||    ||      || ||   a
3'    acg   uauga gg gaggcaggguauuacauucugcaaaaa    cg      uc ga   a
   gca   -uu     u  u                           ----  ----uu  u  aaa 
Get sequence
Deep sequencing
27364 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR514 in [1]. miR1130 is unrelated to mammalian miR-514;

Database links

Mature sequence tae-miR1130a

Accession MIMAT0005365
Previous IDstae-miR1130
Sequence

16 - 

ccuccgucucguaauguaagacg

 - 38

Get sequence
Deep sequencing1275 reads, 116 experiments
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).