Stem-loop sequence cre-MIR1157

AccessionMI0006219 (change log)
DescriptionChlamydomonas reinhardtii miR1157 stem-loop
Literature search

2 open access papers mention cre-MIR1157
(2 sentences)

Stem-loop
        ggc          a                               cu         g      g 
5' uccug   gcaguguucc gcugcaguacaccuggucccgcuauuugaau  cgcugaucg caccau g
   |||||   |||||||||| |||||||||||||||||||||||||||||||  ||||||||| ||||||  
3' aggac   cgucacaagg cgacgucauguggaccagggcgauggacuua  gcgacuagu guggug g
        ---          c                               uc         g      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_18: 251268-251404 [+]
intergenic
Database links

Mature sequence cre-miR1157-5p

Accession MIMAT0005407
Previous IDscre-miR1157*
Sequence

30 - 

accuggucccgcuauuugaauc

 - 51

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1157-3p

Accession MIMAT0005408
Previous IDscre-miR1157
Sequence

92 - 

uucagguagcgggaccaggug

 - 112

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).