Stem-loop sequence dme-mir-959

AccessionMI0005814 (change log)
DescriptionDrosophila melanogaster miR-959 stem-loop
Gene family MIPF0000910; mir-959
Literature search

2 open access papers mention dme-mir-959
(13 sentences)

Stem-loop
   uuaa     uu       - u        gg u        --a    uu 
5'     cuuug  cuauauu c uaguacuc  g ugauaaag   ccuu  c
       |||||  ||||||| | ||||||||  | ||||||||   ||||   
3'     gaaau  gauauaa g auuauggg  c acuguuuc   ggga  u
   -aaa     uu       a u        gg u        cga    cu 
Get sequence
Deep sequencing
4446 reads, 126 reads per million, 43 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 5640940-5641037 [+]
antisense
FBtr0079114 ; CG31646-RA; intron 4
Clustered miRNAs
< 10kb from dme-mir-959
dme-mir-959chr2L: 5640940-5641037 [+]
dme-mir-960chr2L: 5641063-5641155 [+]
dme-mir-961chr2L: 5641191-5641279 [+]
dme-mir-962chr2L: 5641298-5641389 [+]
dme-mir-963chr2L: 5641990-5642078 [+]
dme-mir-964chr2L: 5642102-5642201 [+]
Database links

Mature sequence dme-miR-959-5p

Accession MIMAT0020854
Sequence

20 - 

uuaguacucggguugauaaag

 - 40

Get sequence
Deep sequencing1794 reads, 39 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-959-3p

Accession MIMAT0005473
Previous IDsdme-miR-959
Sequence

61 - 

uugucaucggggguauuaugaa

 - 82

Get sequence
Deep sequencing2651 reads, 43 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).