Stem-loop sequence dme-mir-972

AccessionMI0005829 (change log)
DescriptionDrosophila melanogaster miR-972 stem-loop
Literature search

2 open access papers mention dme-mir-972
(5 sentences)

Stem-loop
   agaa    -a       u  -         uuu         uaacu 
5'     ugau  gggaaau gc uaaauauuu   uuguauaaa     u
       ||||  ||||||| || |||||||||   |||||||||      
3'     acua  cucuuua cg auuuauaag   aacauguuu     u
   --aa    aa       -  g         cau         ucaau 
Get sequence
Deep sequencing
372 reads, 22.6 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19551152-19551242 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-972
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
Database links

Mature sequence dme-miR-972-5p

Accession MIMAT0020869
Sequence

20 - 

uaaauauuuuuuuuguauaaa

 - 40

Get sequence
Deep sequencing13 reads, 6 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-972-3p

Accession MIMAT0005488
Previous IDsdme-miR-972
Sequence

55 - 

uguacaauacgaauauuuaggc

 - 76

Get sequence
Deep sequencing355 reads, 31 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).