Stem-loop sequence dme-mir-999

AccessionMI0005861 (change log)
DescriptionDrosophila melanogaster miR-999 stem-loop
Gene family MIPF0000852; mir-999
Literature search

1 open access papers mention dme-mir-999
(1 sentences)

Stem-loop
   aa  a  cc   --        cc         a      g       u  au 
5'   gg ug  gcu  caauuacc  gacauaguc uacggu aauguug gu  u
     || ||  |||  ||||||||  ||||||||| |||||| ||||||| ||  g
3'   cc ac  cga  guuggugg  cugugucag auguca uuguaac ca  g
   ca  g  -c   cc        cu         a      a       -  ga 
Get sequence
Deep sequencing
627776 reads, 3.95e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 21798227-21798331 [-]
sense
FBtr0084162 ; CASK-RA; intron 2
FBtr0112872 ; CASK-RD; intron 3
FBtr0112873 ; CASK-RE; intron 3
FBtr0301328 ; CASK-RG; intron 3
FBtr0084161 ; CASK-RB; intron 8
FBtr0301327 ; CASK-RF; intron 8
FBtr0330368 ; CASK-RH; intron 8
Clustered miRNAs
< 10kb from dme-mir-999
dme-mir-4969chr3R: 21798514-21798671 [-]
dme-mir-999chr3R: 21798227-21798331 [-]
Database links

Mature sequence dme-miR-999-5p

Accession MIMAT0020899
Sequence

24 - 

acauagucauacggugaauguu

 - 45

Get sequence
Deep sequencing666 reads, 47 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-999-3p

Accession MIMAT0005519
Previous IDsdme-miR-999
Sequence

62 - 

uguuaacuguaagacugugucu

 - 83

Get sequence
Deep sequencing627086 reads, 49 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).