Stem-loop sequence ssy-mir-508

AccessionMI0006601 (change log)
DescriptionSymphalangus syndactylus miR-508 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   u  -     g   c      c       gu  c   c  aaa 
5'  ga gugua ugc cuacuc agagggc  ca uca gu   c
    || ||||| ||| |||||| |||||||  || ||| ||    
3'  cu cacau aug gaugag uuucccg  gu agu ca   u
   a  a     a   a      u       au  u   a  caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssy-miR-508

Accession MIMAT0005754
Sequence

50 - 

ugauuguagcccuuuugaguaga

 - 72

Get sequence
Evidence by similarity; MI0003195

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).