Stem-loop sequence ptr-mir-508

AccessionMI0006624 (change log)
DescriptionPan troglodytes miR-508 stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention ptr-mir-508
(24 sentences)

Stem-loop
   u  -     g   c      c       au         aaa 
5'  ga gugua ugc cuacuc agagggc  cagucaugu   c
    || ||||| ||| |||||| |||||||  |||||||||    
3'  cu cacau aug gaugag uuuuccg  guuaguaca   u
   a  a     a   a      u       au         aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 146968308-146968392 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-508
ptr-mir-508chrX: 146968308-146968392 [-]
ptr-mir-507chrX: 146962370-146962463 [-]
ptr-mir-506chrX: 146962118-146962210 [-]
Database links

Mature sequence ptr-miR-508

Accession MIMAT0005772
Sequence

50 - 

ugauuguagccuuuuugaguaga

 - 72

Get sequence
Evidence by similarity; MI0003195
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).