Stem-loop sequence ptr-mir-510

AccessionMI0006628 (change log)
DescriptionPan troglodytes miR-510 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   cugu        gug    c    - - -a    a  gg         aua 
5'     guaugugu   gugu cuac c c  ggag gu  caaucacau   a
       ||||||||   |||| |||| | |  |||| ||  |||||||||    
3'     cauguaca   caca gaug g g  ucuc ca  guuagugug   u
   ---u        gua    u    u a aa    -  aa         gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 147003632-147003728 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-510
ptr-mir-514-2chrX: 147013243-147013330 [-]
ptr-mir-514-1chrX: 147010556-147010640 [-]
ptr-mir-510chrX: 147003632-147003728 [-]
Database links

Mature sequence ptr-miR-510

Accession MIMAT0005775
Sequence

22 - 

uacccaggagaguggcaaucaca

 - 44

Get sequence
Evidence by similarity; MI0003197
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).