![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1301 |
|||||
Accession | MI0003815 (change log) | ||||
Symbol | HGNC:MIR1301 | ||||
Description | Homo sapiens miR-1301 stem-loop | ||||
Gene family | MIPF0000742; mir-1301 | ||||
Literature search |
![]()
10 open access papers mention hsa-mir-1301 | ||||
Stem-loop |
-- g - - c - gu 5' ggauugug ggggucgcucu aggca c gcagca cu g |||||||| ||||||||||| ||||| | |||||| || c 3' ccugacac cuucagugagg uccgu g cguugu gg u cu a g c a a gg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1301-5p |
|
Accession | MIMAT0026639 |
Sequence |
15 - cgcucuaggcaccgcagca - 33 |
Deep sequencing | 134 reads, 39 experiments |
Evidence | experimental; Illumina [5] |
Predicted targets |
|
Mature sequence hsa-miR-1301-3p |
|
Accession | MIMAT0005797 |
Sequence |
48 - uugcagcugccugggagugacuuc - 71 |
Deep sequencing | 24164 reads, 155 experiments |
Evidence | experimental; Illumina [2,5], 454 [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|
3 |
PMID:19144710
"Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
J Virol. 83:3333-3341(2009).
|
4 |
PMID:19508715
"Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing"
BMC Med Genomics. 2:35(2009).
|
5 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|