Stem-loop sequence mdv1-mir-M5

AccessionMI0005097 (change log)
Previous IDsmdv-mir-M5
DescriptionMareks disease virus type 1 miR-M5 stem-loop
Stem-loop
   u  ug   c   u        au  -     guuuaa 
5'  ca  aac gua gcgaucac  ug acacg      a
    ||  ||| ||| ||||||||  || |||||       
3'  gu  uug cau ugcuggug  au ugugc      a
   g  gu   u   c        cu  g     auacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:AF243438.1) Overlapping transcripts
AF243438.1: 7945-8019 [-]
intergenic
AF243438.1: 133601-133675 [+]
intergenic
Clustered miRNAs
< 10kb from mdv1-mir-M5
mdv1-mir-M1AF243438.1: 136864-136939 [+]
mdv1-mir-M31AF243438.1: 136539-136607 [+]
mdv1-mir-M11AF243438.1: 136050-136114 [+]
mdv1-mir-M4AF243438.1: 134363-134428 [+]
mdv1-mir-M2AF243438.1: 134223-134296 [+]
mdv1-mir-M3AF243438.1: 134075-134144 [+]
mdv1-mir-M12AF243438.1: 133888-133949 [+]
mdv1-mir-M5AF243438.1: 133601-133675 [+]
mdv1-mir-M9AF243438.1: 133369-133438 [+]
mdv1-mir-M9AF243438.1: 8182-8251 [-]
mdv1-mir-M5AF243438.1: 7945-8019 [-]
mdv1-mir-M12AF243438.1: 7671-7732 [-]
mdv1-mir-M3AF243438.1: 7476-7545 [-]
mdv1-mir-M2AF243438.1: 7324-7397 [-]
mdv1-mir-M4AF243438.1: 7192-7257 [-]
mdv1-mir-M11AF243438.1: 5506-5570 [-]
mdv1-mir-M31AF243438.1: 5013-5081 [-]
mdv1-mir-M1AF243438.1: 4681-4756 [-]
Database links

Mature sequence mdv1-miR-M5-5p

Accession MIMAT0005802
Previous IDsmdv1-miR-M5*
Sequence

6 - 

aaccguaugcgaucacauugac

 - 27

Get sequence
Evidence experimental; Northern [2], cloned [3], Illumina [4]

Mature sequence mdv1-miR-M5-3p

Accession MIMAT0003926
Previous IDsmdv-miR-M5;mdv1-miR-M5
Sequence

47 - 

uguguaucguggucgucuacugu

 - 69

Get sequence
Evidence experimental; cloned [1-3], Northern [1-2], Illumina [4]

References

1
PMID:16912324 "Marek's disease virus encodes MicroRNAs that map to meq and the latency-associated transcript" Burnside J, Bernberg E, Anderson A, Lu C, Meyers BC, Green PJ, Jain N, Isaacs G, Morgan RW J Virol. 80:8778-8786(2006).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).
4
PMID:18842708 "Sequence conservation and differential expression of Marek's disease virus microRNAs" Morgan R, Anderson A, Bernberg E, Kamboj S, Huang E, Lagasse G, Isaacs G, Parcells M, Meyers BC, Green PJ, Burnside J J Virol. 82:12213-12220(2008).