Stem-loop sequence odi-mir-1492

AccessionMI0007104 (change log)
DescriptionOikopleura dioica miR-1492 stem-loop
Stem-loop
   cuaauuau     -      g    -a  u   uu       a    g    au 
5'         gagca gaucag cagg  cg ggu  ugugcga accg cgaa  c
           ||||| |||||| ||||  || |||  ||||||| |||| ||||  u
3'         uucgu cuaguc guuc  gc cca  acacguu uggu guuu  g
   -----acu     u      -    cg  -   -u       a    a    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence odi-miR-1492

Accession MIMAT0006045
Sequence

66 - 

uauugcacauacccggccuug

 - 86

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).