Stem-loop sequence odi-mir-92a

AccessionMI0007143 (change log)
DescriptionOikopleura dioica miR-92a stem-loop
Stem-loop
   acaguaauacu       --g      -    ua uca     g uu      cgau 
5'            ugguuga   auucua gguc  g   gagug g  uacaga    u
              |||||||   |||||| ||||  |   ||||| |  ||||||    u
3'            aucaauu   uaaggu ccgg  c   cucac u  augucu    u
   -----------       uca      u    cc -ug     g -u      auau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence odi-miR-92a

Accession MIMAT0006080
Sequence

66 - 

uauugcacucgucccggccuug

 - 87

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).