Stem-loop sequence odi-mir-92b

AccessionMI0007144 (change log)
DescriptionOikopleura dioica miR-92b stem-loop
Stem-loop
   uaacc      aaag    cc     c     a    uu    aacuaaaa 
5'      uuuucg    ucua  agucg gauua gugc  uguu        c
        ||||||    ||||  ||||| ||||| ||||  ||||        u
3'      aagagc    agau  ucagc cuggu cacg  auaa        a
   ---ac      guga    aa     c     -    uu    auuauaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence odi-miR-92b

Accession MIMAT0006081
Sequence

65 - 

uauugcacuggucccgacuaau

 - 86

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).