Stem-loop sequence cin-mir-92b

AccessionMI0007161 (change log)
DescriptionCiona intestinalis miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention cin-mir-92b
(1 sentences)

Stem-loop
   aaaaagcuccauu   -     uuac   c    uu    c      cc   uuaua 
5'              uuc gcagu    uug aggu  ggac ggugca  aga     u
                ||| |||||    ||| ||||  |||| ||||||  |||      
3'              aag cguca    aac uccg  ccug ucacgu  ucu     a
   ------------c   u     --ua   u    gc    u      ua   uuaga 
Get sequence
Deep sequencing
2661 reads, 750 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1p: 2635676-2635776 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-92b
cin-mir-92b1p: 2635676-2635776 [-]
cin-mir-92e1p: 2635396-2635447 [-]
cin-mir-40381p: 2634947-2635001 [-]
cin-mir-92e1p: 2628718-2628769 [-]
Database links

Mature sequence cin-miR-92b-5p

Accession MIMAT0015254
Previous IDscin-miR-92b*
Sequence

30 - 

agguuuggaccggugcacca

 - 49

Get sequence
Deep sequencing168 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-miR-92b-3p

Accession MIMAT0006097
Previous IDscin-miR-92b
Sequence

66 - 

uauugcacuugucccggccuu

 - 86

Get sequence
Deep sequencing2358 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2