Stem-loop sequence cin-mir-92c

AccessionMI0007162 (change log)
DescriptionCiona intestinalis miR-92c stem-loop
Gene family MIPF0000509; mir-92
Literature search

1 open access papers mention cin-mir-92c
(1 sentences)

Stem-loop
   ucccaaacuuauaaacug    u c    u      u  -   a     u    uugu 
5'                   uacc g auac uaggcc gg cga gugca ugcg    c
                     |||| | |||| |||||| || ||| ||||| ||||     
3'                   augg c uaug aucugg cc gcu cacgu augc    a
   --------------aaaa    u -    u      c  u   -     u    uggu 
Get sequence
Deep sequencing
2467 reads, 750 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
3p: 1865219-1865319 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-92c
cin-mir-92a3p: 1864426-1864526 [+]
cin-mir-92d3p: 1864796-1864851 [+]
cin-mir-92c3p: 1865219-1865319 [+]
Database links

Mature sequence cin-miR-92c-5p

Accession MIMAT0015255
Previous IDscin-miR-92c*
Sequence

32 - 

aggccuggcgaagugcauug

 - 51

Get sequence
Deep sequencing236 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-miR-92c-3p

Accession MIMAT0006098
Previous IDscin-miR-92c
Sequence

66 - 

uauugcacucgucccggucuau

 - 87

Get sequence
Deep sequencing2231 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2