Stem-loop sequence cin-mir-281

AccessionMI0007179 (change log)
DescriptionCiona intestinalis miR-281 stem-loop
Gene family MIPF0000472; mir-281
Literature search

1 open access papers mention cin-mir-281
(1 sentences)

Stem-loop
   uuggaaaauauauaacu   -      guguc                u     aca 
5'                  guc cagugc     ggagaguaauuucaug uagug   u
                    ||| ||||||     |||||||||||||||| |||||   c
3'                  cgg gucgcg     ucucucguugagguac gucau   a
   ---------------ac   a      auuau                u     cau 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_64: 295962-296062 [-]
intergenic
Database links

Mature sequence cin-miR-281-5p

Accession MIMAT0015265
Previous IDscin-miR-281*
Sequence

31 - 

cggagaguaauuucauguu

 - 49

Get sequence
Evidence experimental; Illumina [2]

Mature sequence cin-miR-281-3p

Accession MIMAT0006114
Previous IDscin-miR-281
Sequence

66 - 

ugucauggaguugcucucuuauu

 - 88

Get sequence
Deep sequencing20 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2