Stem-loop sequence csa-mir-92a

AccessionMI0007189 (change log)
DescriptionCiona savignyi miR-92a stem-loop
Gene family MIPF0000509; mir-92
Stem-loop
   aucauaaccacaacuaug      u    c      -a     a     u    -     
5'                   uaucaa augc uagacc  gacaa gugua ugcg uugu 
                     |||||| |||| ||||||  ||||| ||||| |||| ||| u
3'                   augguu uacg aucugg  cuguu cacgu augc aacg 
   ------------gaaaga      -    a      cc     -     u    u     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_1: 1336385-1336487 [+]
intergenic
Clustered miRNAs
< 10kb from csa-mir-92a
csa-mir-92breftig_1: 1335375-1335474 [+]
csa-mir-92creftig_1: 1335536-1335626 [+]
csa-mir-92areftig_1: 1336385-1336487 [+]
Database links

Mature sequence csa-miR-92a

Accession MIMAT0006123
Sequence

66 - 

uauugcacuugucccggucua

 - 86

Get sequence
Evidence by similarity; MI0007143

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).