Stem-loop sequence csa-mir-92b

AccessionMI0007190 (change log)
DescriptionCiona savignyi miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   cccagccugacaaagaccuacuga    ag     c gu   uu    c   u    uc 
5'                         auac  ugcug g  cgg  uagg gca uauc  u
                           ||||  ||||| |  |||  |||| ||| ||||   
3'                         uaug  augau c  gcc  guuc cgu auag  g
   --------------------ucag    aa     u ug   cu    a   u    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_1: 1335375-1335474 [+]
intergenic
Clustered miRNAs
< 10kb from csa-mir-92b
csa-mir-92breftig_1: 1335375-1335474 [+]
csa-mir-92creftig_1: 1335536-1335626 [+]
csa-mir-92areftig_1: 1336385-1336487 [+]
Database links

Mature sequence csa-miR-92b

Accession MIMAT0006124
Sequence

66 - 

uauugcacuugucccggucuu

 - 86

Get sequence
Evidence by similarity; MI0007143

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).