Stem-loop sequence csa-mir-92c

AccessionMI0007191 (change log)
DescriptionCiona savignyi miR-92c stem-loop
Gene family MIPF0000509; mir-92
Literature search

1 open access papers mention csa-mir-92c
(5 sentences)

Stem-loop
   guauaua   g      a      a ugu      uu     cg  g 
5'        gca ucagga cggccg g   ggugua  guacu  ua a
          ||| |||||| |||||| |   ||||||  |||||  ||  
3'        cgu gguucu gccggc c   ccacgu  uauga  au a
   ---uccg   g      a      c ugu      --     ca  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_1: 1335536-1335626 [+]
intergenic
Clustered miRNAs
< 10kb from csa-mir-92c
csa-mir-92breftig_1: 1335375-1335474 [+]
csa-mir-92creftig_1: 1335536-1335626 [+]
csa-mir-92areftig_1: 1336385-1336487 [+]
Database links

Mature sequence csa-miR-92c

Accession MIMAT0006125
Sequence

57 - 

uauugcaccugucccggccgau

 - 78

Get sequence
Evidence by similarity; MI0007143

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).