Stem-loop sequence csa-mir-141

AccessionMI0007196 (change log)
DescriptionCiona savignyi miR-141 stem-loop
Gene family MIPF0000019; mir-8
Literature search

1 open access papers mention csa-mir-141
(1 sentences)

Stem-loop
   --u                   c    c       uc     c 
5'    uggucgucggucgcaucuu auca gcggugu  uagaa u
      ||||||||||||||||||| |||| |||||||  |||||  
3'    aucggcggcuagcguagaa uggu ugucaca  aucuu c
   uuc                   a    c       --     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_613: 31866-31949 [+]
sense
Clustered miRNAs
< 10kb from csa-mir-141
csa-mir-200reftig_613: 31353-31432 [+]
csa-mir-141reftig_613: 31866-31949 [+]
Database links

Mature sequence csa-miR-141

Accession MIMAT0006129
Sequence

48 - 

uaacacugucugguaaagaugc

 - 69

Get sequence
Evidence by similarity; MI0007168

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).