Stem-loop sequence csa-mir-281

AccessionMI0007205 (change log)
DescriptionCiona savignyi miR-281 stem-loop
Gene family MIPF0000472; mir-281
Stem-loop
   aauucguuuauuuuacau    -     gu  c       u        c    cua    
5'                   guca agugc  gu ggagggu auuucaug cggu   gca 
                     |||| |||||  || ||||||| |||||||| ||||   || u
3'                   cggu ucgcg  ua ucucucg ugagguac gucg   cgu 
   ---------------auu    a     gu  c       u        u    ---    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_67: 861516-861617 [+]
intergenic
Database links

Mature sequence csa-miR-281

Accession MIMAT0006138
Sequence

66 - 

ugucauggaguugcucucucauu

 - 88

Get sequence
Evidence by similarity; MI0007148

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).