Stem-loop sequence mml-mir-92b

AccessionMI0007607 (change log)
DescriptionMacaca mulatta miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   c     cc   c    g     ga       c            uucuu 
5'  gggcc  ggg gggc ggagg  cgggacg ggugcaguguug     u
    |||||  ||| |||| |||||  ||||||| ||||||||||||     c
3'  cccgg  ccc cccg ccucc  gcccugc ucacguuauaac     c
   -     -c   -    g     -g       -            cgccc 
Get sequence
Deep sequencing
41360 reads, 167 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 129891862-129891957 [+]
intergenic
Database links

Mature sequence mml-miR-92b-5p

Accession MIMAT0026810
Sequence

20 - 

agggacgggacgcggugcaguguu

 - 43

Get sequence
Deep sequencing174 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-92b-3p

Accession MIMAT0006177
Sequence

61 - 

uauugcacucgucccggccucc

 - 82

Get sequence
Deep sequencing41167 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).