Stem-loop sequence mml-mir-612

AccessionMI0007868 (change log)
DescriptionMacaca mulatta miR-612 stem-loop
Gene family MIPF0000464; mir-612
Stem-loop
   ------   -ca     acc   -cu              -        -a  a 
5'       ucu   ucugg   cca   ggggagggcuucug agcuccuc  gc c
         |||   |||||   |||   |||||||||||||| ||||||||  ||  
3'       agg   ggacc   ggu   ucccucccggggac ucggggag  cg u
   acucuc   aca     gac   acc              c        ga  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 8970064-8970163 [-]
intergenic
Database links

Mature sequence mml-miR-612

Accession MIMAT0006464
Sequence

17 - 

cuggggagggcuucugagcuccu

 - 39

Get sequence
Evidence by similarity; MI0003625
Predicted targets

References

1