Stem-loop sequence mml-mir-631

AccessionMI0007878 (change log)
DescriptionMacaca mulatta miR-631 stem-loop
Gene family MIPF0000508; mir-631
Stem-loop
   gu      cc    uaga      c   a  -      a 
5'   ggagag  uggu    ccuggc cag cc ucagcu c
     ||||||  ||||    |||||| ||| || |||||| a
3'   ccucuc  accg    ggacug guc gg agucga c
   --      ac    ---g      a   a  u      a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 52678504-52678578 [-]
intergenic
Database links

Mature sequence mml-miR-631

Accession MIMAT0006476
Sequence

16 - 

agaccuggcccagaccucagc

 - 36

Get sequence
Evidence by similarity; MI0003645
Predicted targets

References

1