Stem-loop sequence mml-mir-643

AccessionMI0007886 (change log)
DescriptionMacaca mulatta miR-643 stem-loop
Gene family MIPF0000488; mir-643
   ---a   acugauacg  u                         a   gg  u 
5'     cca         ca uaucuaccugagcuagaauacaagu guu  ug c
       |||         || ||||||||||||||||||||||||| |||  ||  
3'     ggu         gu auagauggacucgaucuuauguuca cag  ac u
   aaaa   -------aa  c                         -   ag  u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 47493538-47493634 [+]
Database links

Mature sequence mml-miR-643

Accession MIMAT0006484

61 - 


 - 82

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003658
Predicted targets
