Stem-loop sequence mml-mir-920

AccessionMI0007927 (change log)
DescriptionMacaca mulatta miR-920 stem-loop
Gene family MIPF0000495; mir-920
Stem-loop
   ---  ag     -      aaga      -    gaaga 
5'    gu  uuguu cuauag    ccugga ugug     g
      ||  ||||| ||||||    |||||| ||||      
3'    ca  ggcga gguguc    ggaccu acac     c
   gca  au     a      gagg      c    agaau 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 25128633-25128707 [+]
intergenic
Database links

Mature sequence mml-miR-920

Accession MIMAT0006532
Sequence

51 - 

ggggagcuguggaagcggua

 - 70

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence by similarity; MI0005712
Predicted targets

References

1