Stem-loop sequence mml-mir-939

AccessionMI0007935 (change log)
DescriptionMacaca mulatta miR-939 stem-loop
Gene family MIPF0000490; mir-939
Stem-loop
   ugug  ca    c         u     u ug     -   c 
5'     gg  gggc cuggggagc gaggc c  ggggu ggc g
       ||  |||| ||||||||| ||||| |  ||||| |||  
3'     cc  ucug gaccccucg cuccg g  cccca ucg g
   -gug  ag    u         u     - gu     g   g 
Get sequence
Deep sequencing
91 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 143638752-143638834 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-939
mml-mir-1234chr8: 143644566-143644633 [-]
mml-mir-939chr8: 143638752-143638834 [-]
Database links

Mature sequence mml-miR-939

Accession MIMAT0006540
Sequence

15 - 

uggggagcugaggcucugggggug

 - 38

Get sequence
Deep sequencing81 reads, 9 experiments
Evidence by similarity; MI0005761
Predicted targets

References

1