Stem-loop sequence cfa-mir-32

AccessionMI0007992 (change log)
DescriptionCanis familiaris miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
   --   ug     u            - uu  c 
5'   uau  cacau acuaaguugcau g  gu a
     |||  ||||| |||||||||||| |  ||  
3'   aua  gugug ugauuuaacgua c  cg c
   uu   gu     -            a uc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr11: 64197130-64197191 [-]
sense
ENSCAFT00000004537 ; TMEM245-201; intron 14
Database links

Mature sequence cfa-miR-32

Accession MIMAT0006597
Sequence

1 - 

uauugcacauuacuaaguugcau

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).