Stem-loop sequence cfa-mir-425

AccessionMI0008038 (change log)
DescriptionCanis familiaris miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
   --aau       u  c     u  ----ag   g 
5'      gacacga ca ucccg ug      ugg c
        ||||||| || ||||| ||      |||  
3'      cugugcu gu agggc ac      acc a
   cccgc       -  a     u  cgaaga   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr20: 40144613-40144675 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-425
cfa-mir-191chr20: 40144135-40144198 [+]
cfa-mir-425chr20: 40144613-40144675 [+]
Database links

Mature sequence cfa-miR-425

Accession MIMAT0006639
Sequence

1 - 

aaugacacgaucacucccguuga

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).