Stem-loop sequence cfa-mir-143

AccessionMI0008092 (change log)
DescriptionCanis familiaris miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   -- g         g      u  -  ag 
5'   g ugcagugcu caucuc gg uc  u
     | ||||||||| |||||| || ||   
3'   c augucacga guagag cu ag  u
   cu g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr4: 59534535-59534589 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-143
cfa-mir-143chr4: 59534535-59534589 [-]
cfa-mir-145chr4: 59533128-59533210 [-]
Database links

Mature sequence cfa-miR-143

Accession MIMAT0006682
Sequence

35 - 

ugagaugaagcacuguagcuc

 - 55

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).