Stem-loop sequence cfa-mir-92b

AccessionMI0008119 (change log)
DescriptionCanis familiaris miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -a   a       c            uucuc 
5'   ggg cgggacg ggugcaguguug     u
     ||| ||||||| ||||||||||||     c
3'   ucc gcccugc ucacguuauaac     c
   cc   g       -            cgccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr7: 42338480-42338542 [-]
antisense
ENSCAFT00000026973 ; cfa-mir-92b-201; exon 23
Database links

Mature sequence cfa-miR-92b

Accession MIMAT0006703
Sequence

42 - 

uauugcacucgucccggccucc

 - 63

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).