Stem-loop sequence oan-mir-490

AccessionMI0006670 (change log)
DescriptionOrnithorhynchus anatinus miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   ---------gggagacuuggaaaguuca          c      --         g   caa guu 
5'                             cgguucgacg caugga  ucuccaggu ggu   g   a
                               |||||||||| ||||||  ||||||||| |||   |    
3'                             gucgagcugu guaccu  ggaggucca cca   c   g
   ccccugagaacgcagacaacgagcacua          c      ca         a   -cg aga 
Get sequence
Deep sequencing
350 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
10: 8756531-8756654 [+]
intergenic
Database links

Mature sequence oan-miR-490-5p

Accession MIMAT0006810
Previous IDsoan-miR-490
Sequence

30 - 

ccauggaucuccaggugggu

 - 49

Get sequence
Deep sequencing109 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-490-3p

Accession MIMAT0006811
Previous IDsoan-miR-490*
Sequence

67 - 

caaccuggaggacuccaugcugu

 - 89

Get sequence
Deep sequencing238 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).