Stem-loop sequence oan-mir-106

AccessionMI0006693 (change log)
DescriptionOrnithorhynchus anatinus miR-106 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
       gg  -      ag   u    u    -aa           g     g   c uu 
5' acuu  ug uuggau  gcc uggu gugc   aagugcuuaca ugcag uag u  u
   ||||  || ||||||  ||| |||| ||||   ||||||||||| ||||| ||| |   
3' ugag  ac aacuua  cgg acca uacg   uucacgaaugu acguc auc a  a
       ua  u      -a   u    u    auc           a     -   c ug 
Get sequence
Deep sequencing
30702 reads, 500 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
6: 8561054-8561167 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-106
oan-mir-1066: 8561054-8561167 [+]
oan-mir-186: 8561213-8561342 [+]
oan-mir-20b6: 8561429-8561534 [+]
oan-mir-19b-16: 8561559-8561661 [+]
oan-mir-92a-16: 8561691-8561810 [+]
oan-mir-3636: 8561848-8561936 [+]
Database links

Mature sequence oan-miR-106-5p

Accession MIMAT0006849
Previous IDsoan-miR-106
Sequence

30 - 

aaaagugcuuacagugcaggu

 - 50

Get sequence
Deep sequencing30210 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-106-3p

Accession MIMAT0006850
Previous IDsoan-miR-106*
Sequence

65 - 

acugcaauguaagcacuucuag

 - 86

Get sequence
Deep sequencing490 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).