Stem-loop sequence oan-mir-92a-1

AccessionMI0006697 (change log)
DescriptionOrnithorhynchus anatinus miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
         -  -       g a  ga             g     uu  u   u     gu     
5' aucuga ga agguuuu c cu  uuccuccaugggu gggau  gu gca uacuu  agcu 
   |||||| || ||||||| | ||  ||||||||||||| |||||  || ||| |||||  ||| a
3' uggacu cu uucagga g ga  agggagguguccg cccug  ca cgu augag  uugu 
         a  g       - -  --             g     uu  -   u     au     
Get sequence
Deep sequencing
72420 reads, 1e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
6: 8561691-8561810 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-92a-1
oan-mir-1066: 8561054-8561167 [+]
oan-mir-186: 8561213-8561342 [+]
oan-mir-20b6: 8561429-8561534 [+]
oan-mir-19b-16: 8561559-8561661 [+]
oan-mir-92a-16: 8561691-8561810 [+]
oan-mir-3636: 8561848-8561936 [+]
Database links

Mature sequence oan-miR-92a-1-5p

Accession MIMAT0006857
Previous IDsoan-miR-92a-1*
Sequence

32 - 

ggguggggauuuguugcauuacu

 - 54

Get sequence
Deep sequencing53 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-92a-3p

Accession MIMAT0006858
Previous IDsoan-miR-92a
Sequence

72 - 

uauugcacuugucccggccugu

 - 93

Get sequence
Deep sequencing145049 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).