Stem-loop sequence oan-mir-1341

AccessionMI0006706 (change log)
DescriptionOrnithorhynchus anatinus miR-1341 stem-loop
Stem-loop
        - g -     --          gcgugaugacaacuuuggccguaggaaagcuuggggaccgguug 
5' ggagg g g cuccu  ccggcagugu                                            g
   ||||| | | |||||  ||||||||||                                            u
3' cuucc c c gaggg  ggccgucacg                                            c
        a g a     ag          uaagucccauugauacugucacggcagugucccucgaagcacuu 
Get sequence
Deep sequencing
808 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig10522: 37905-38045 [-]
intergenic
Database links

Mature sequence oan-miR-1341

Accession MIMAT0006872
Sequence

22 - 

gugcgugaugacaacuuuggccgu

 - 45

Get sequence
Deep sequencing360 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).