Stem-loop sequence oan-mir-1420d

AccessionMI0006738 (change log)
DescriptionOrnithorhynchus anatinus miR-1420d stem-loop
Gene family MIPF0000574; mir-1420
Stem-loop
   uuauacu     u   uau      cu  c    ug       u   c c     ggau 
5'        gcuag gau   ucaacu  gc uauc  gccuggu gca u ucuga    a
          ||||| |||   ||||||  || ||||  ||||||| ||| | |||||    u
3'        cgguu cug   gguugg  cg guag  uggacca cgu a agacu    a
   -aaucuu     -   ---      uu  u    gu       u   u a     aaaa 
Get sequence
Deep sequencing
76 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig1754: 88499-88614 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-1420d
oan-mir-1420aContig1754: 86316-86413 [+]
oan-mir-1420bContig1754: 86458-86567 [+]
oan-mir-1420cContig1754: 87021-87126 [+]
oan-mir-1420dContig1754: 88499-88614 [+]
oan-mir-1420eContig1754: 88652-88765 [+]
oan-mir-1347Contig1754: 88992-89119 [+]
Database links

Mature sequence oan-miR-1420d-5p

Accession MIMAT0006927
Previous IDsoan-miR-1420d*
Sequence

32 - 

aucuggccugguugcacucucu

 - 53

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-1420d-3p

Accession MIMAT0006928
Previous IDsoan-miR-1420d
Sequence

71 - 

aaauugcuaccagguuggaugu

 - 92

Get sequence
Deep sequencing73 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).