Stem-loop sequence oan-mir-200a

AccessionMI0006744 (change log)
DescriptionOrnithorhynchus anatinus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
        gugccaacug       -  g        -             c    uu     
5' gcuug          ugguccu cc ugggcauc uuacuagacagug ugga  uggg 
   |||||          ||||||| || |||||||| ||||||||||||| ||||  ||| a
3' cgagc          accagga gg acuuguag aauggucugucac aucu  aucu 
        --aucuccua       a  a        c             a    -c     
Get sequence
Deep sequencing
11685 reads, 180 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig19080: 5482-5595 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-200a
oan-mir-200bContig19080: 7770-7878 [-]
oan-mir-200aContig19080: 5482-5595 [-]
oan-mir-1349Contig19080: 2589-2682 [-]
Database links

Mature sequence oan-miR-200a-5p

Accession MIMAT0006935
Previous IDsoan-miR-200a*
Sequence

30 - 

caucuuacuagacagugcugga

 - 51

Get sequence
Deep sequencing456 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-200a-3p

Accession MIMAT0006936
Previous IDsoan-miR-200a
Sequence

66 - 

uaacacugucugguaacgauguu

 - 88

Get sequence
Deep sequencing11185 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).