Stem-loop sequence oan-mir-155

AccessionMI0006775 (change log)
DescriptionOrnithorhynchus anatinus miR-155 stem-loop
Gene family MIPF0000157; mir-155
Stem-loop
      acgc  -u        g  c           u  u a        uuc  u 
5' ggg    cg  gggccgca gu guuaaugcuaa cg g uagggguu   uc g
   |||    ||  |||||||| || ||||||||||| || | ||||||||   || u
3' ccc    gc  cccggcgu ca cgauuacgauu gc c guccccag   ag c
      --aa  uc        g  a           -  - c        -uc  u 
Get sequence
Deep sequencing
3405 reads, 100 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig248467: 539-643 [+]
intergenic
Database links

Mature sequence oan-miR-155-5p

Accession MIMAT0006988
Previous IDsoan-miR-155
Sequence

24 - 

uuaaugcuaaucgugauaggggu

 - 46

Get sequence
Deep sequencing3402 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-155-3p

Accession MIMAT0006989
Previous IDsoan-miR-155*
Sequence

64 - 

ccccugcccguuagcauuagc

 - 84

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).