Stem-loop sequence oan-mir-215

AccessionMI0006783 (change log)
DescriptionOrnithorhynchus anatinus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   -----caauccaggaa   au     a     aaa  a     -   u           aua 
5'                 gaa  ggugu cagga   ug ccuau gaa ugacagacagu   u
                   |||  ||||| |||||   || ||||| ||| |||||||||||    
3'                 cuu  ccgua gucuu   ac ggaug cuu acugucuguua   u
   gaccgcggccucguca   --     c     gaa  c     u   u           gau 
Get sequence
Deep sequencing
649096 reads, 1.26e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig27098: 4335-4452 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-215
oan-mir-194-1Contig27098: 3308-3405 [+]
oan-mir-215Contig27098: 4335-4452 [+]
Database links

Mature sequence oan-miR-215-5p

Accession MIMAT0007000
Previous IDsoan-miR-215
Sequence

30 - 

augaccuaugaauugacagac

 - 50

Get sequence
Deep sequencing649025 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-215-3p

Accession MIMAT0007001
Previous IDsoan-miR-215*
Sequence

66 - 

ucugucauuucuguaggccaaa

 - 87

Get sequence
Deep sequencing71 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).