Stem-loop sequence oan-mir-1371

AccessionMI0006807 (change log)
DescriptionOrnithorhynchus anatinus miR-1371 stem-loop
Stem-loop
       uuuag   -aaa       aaacuauuagaugaggacucugagaagaggaggaagauagaagucuuagga 
5' ugac     aug    ggcagua                                                   c
   ||||     |||    |||||||                                                    
3' auug     uac    uugucgu                                                   a
       -uuua   auag       aaaccucaaaauuacaaugaguacuuugacugcguacugacagcaaaacag 
Get sequence
Deep sequencing
757 reads, 275 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig4797: 7108-7255 [+]
intergenic
Database links

Mature sequence oan-miR-1371

Accession MIMAT0007036
Sequence

30 - 

uagaugaggacucugaga

 - 47

Get sequence
Deep sequencing753 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).