Stem-loop sequence oan-mir-124a-1

AccessionMI0006854 (change log)
DescriptionOrnithorhynchus anatinus miR-124a-1 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   cacua   cu u    cc        a   ga        uaaau 
5'      ggc  g cucu  guguucac gcg  ccuugauu     u
        |||  | ||||  |||||||| |||  ||||||||     u
3'      ccg  c gaga  cguaagug cgc  ggaauuaa     g
   -gaaa   ac c    ac        g   ac        cacau 
Get sequence
Deep sequencing
135168 reads, 1.64e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig9524: 20318-20409 [+]
intergenic
Database links

Mature sequence oan-miR-124a-5p

Accession MIMAT0007113
Previous IDsoan-miR-124*
Sequence

18 - 

cguguucacagcggaccuugau

 - 39

Get sequence
Deep sequencing3061 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-124a-1-3p

Accession MIMAT0007114
Previous IDsoan-miR-124
Sequence

57 - 

uaaggcacgcggugaaugcca

 - 77

Get sequence
Deep sequencing133576 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).