Stem-loop sequence oan-mir-221

AccessionMI0006866 (change log)
DescriptionOrnithorhynchus anatinus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
          uuga   a    -  ug   u         aauu    auu  u 
5' uucaggu    ggc ugaa cc  gca acaauguag    cugu   ug u
   |||||||    ||| |||| ||  ||| |||||||||    ||||   || a
3' aggucca    ucg acuu gg  cgu uguuacauc    gaca   ac a
          ----   a    u  gu   c         ----    ---  g 
Get sequence
Deep sequencing
138405 reads, 2.36e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra222: 5162753-5162845 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-221
oan-mir-222aUltra222: 5162121-5162230 [+]
oan-mir-221Ultra222: 5162753-5162845 [+]
Database links

Mature sequence oan-miR-221-5p

Accession MIMAT0007134
Previous IDsoan-miR-221*
Sequence

19 - 

accuggcauacaauguagaau

 - 39

Get sequence
Deep sequencing101197 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-221-3p

Accession MIMAT0007135
Previous IDsoan-miR-221
Sequence

59 - 

agcuacauugucugcuggguuu

 - 80

Get sequence
Deep sequencing37144 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).