Stem-loop sequence oan-mir-1384

AccessionMI0006867 (change log)
DescriptionOrnithorhynchus anatinus miR-1384 stem-loop
Stem-loop
   cuauuaaccgaagcaacugcuuucuuuuucuuuuuauuguacu     -uu     u    uu   c   ug aauuu   g 
5'                                            ccauu   gaggu ugga  cuc ugu  c     uug a
                                              |||||   ||||| ||||  ||| |||  |     |||  
3'                                            gguaa   cuucg gucu  gag acg  g     aac a
   -------------------------------------------     ugu     u    uu   -   gu -----   c 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra222: 8034010-8034125 [-]
sense
ENSOANT00000011316 ; SYTL5-201; intron 1
Database links

Mature sequence oan-miR-1384

Accession MIMAT0007136
Sequence

70 - 

ugcaauuuuuggaaccaa

 - 87

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).