Stem-loop sequence oan-mir-143

AccessionMI0006871 (change log)
DescriptionOrnithorhynchus anatinus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   ---gaug      ag   a  g         g      u  -   g 
5'        ucuccc  ccc ag ugcagugcu caucuc gg uca u
          ||||||  ||| || ||||||||| |||||| || |||  
3'        ggaggg  ggg uc augucacga guagag cu agu u
   cugucga      aa   c  g         a      u  g   g 
Get sequence
Deep sequencing
2503929 reads, 7.31e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra279: 183115-183204 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-143
oan-mir-143Ultra279: 183115-183204 [-]
oan-mir-145Ultra279: 180919-181016 [-]
Database links

Mature sequence oan-miR-143-5p

Accession MIMAT0007143
Previous IDsoan-miR-143*
Sequence

17 - 

aggugcagugcugcaucucuggu

 - 39

Get sequence
Deep sequencing2051 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-143-3p

Accession MIMAT0007144
Previous IDsoan-miR-143
Sequence

52 - 

ugagaugaagcacuguagcuc

 - 72

Get sequence
Deep sequencing2501875 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).