Stem-loop sequence oan-mir-425

AccessionMI0006880 (change log)
DescriptionOrnithorhynchus anatinus miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
        ----a    uc        au        cac     u  a  ggaca 
5' gggag     gaaa  gcuuugga  gacacgau   ucccg ug gc     g
   |||||     ||||  ||||||||  ||||||||   ||||| || ||     c
3' cccuc     cuuu  cgaaaccu  cugugcua   agggc ac cg     c
        cgggg    cu        gc        -ua     u  -  aagaa 
Get sequence
Deep sequencing
5859 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra32: 75903-76005 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-425
oan-mir-191Ultra32: 73507-73620 [+]
oan-mir-425Ultra32: 75903-76005 [+]
Database links

Mature sequence oan-miR-425-5p

Accession MIMAT0007154
Previous IDsoan-miR-425
Sequence

20 - 

aaugacacgaucacucccguuga

 - 42

Get sequence
Deep sequencing5502 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-425-3p

Accession MIMAT0007155
Previous IDsoan-miR-425*
Sequence

60 - 

caucgggaauaucguguccg

 - 79

Get sequence
Deep sequencing356 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).