Stem-loop sequence oan-mir-1419d

AccessionMI0006944 (change log)
DescriptionOrnithorhynchus anatinus miR-1419d stem-loop
Gene family MIPF0000570; mir-1419
Stem-loop
   ---gcggugaacggcgauggcaucacaccca         -   u    -----     c 
5'                                gugcuggag aug cauc     acgug u
                                  ||||||||| ||| ||||     |||||  
3'                                cacgaccuc uac guag     ugcgc a
   cggcaagguagaaagggcuaccugugcgcac         c   u    uaccu     c 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 44298117-44298229 [-]
antisense
Clustered miRNAs
< 10kb from oan-mir-1419d
oan-mir-1414X1: 44306726-44306812 [-]
oan-mir-1419c-3X1: 44304901-44305008 [-]
oan-mir-1421ag-2X1: 44303617-44303684 [-]
oan-mir-1421y-3X1: 44303056-44303140 [-]
oan-mir-1421aiX1: 44301501-44301574 [-]
oan-mir-1421ab-1X1: 44298540-44298604 [-]
oan-mir-1419dX1: 44298117-44298229 [-]
oan-mir-1419c-2X1: 44296776-44296886 [-]
oan-mir-1421ag-1X1: 44295490-44295574 [-]
oan-mir-1421y-2X1: 44294920-44295029 [-]
oan-mir-1421ab-2X1: 44293810-44293911 [-]
oan-mir-1421aaX1: 44291691-44291783 [-]
oan-mir-1419c-1X1: 44291006-44291114 [-]
oan-mir-1421zX1: 44289986-44290072 [-]
Database links

Mature sequence oan-miR-1419d-5p

Accession MIMAT0007253
Previous IDsoan-miR-1419d
Sequence

26 - 

ccagugcuggagaugucauca

 - 46

Get sequence
Deep sequencing36 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-1419d-3p

Accession MIMAT0007254
Previous IDsoan-miR-1419d*
Sequence

66 - 

augucauccuccagcaccacg

 - 86

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).